Promega Corporation

pUC/M13 Sequencing Primers

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC.

Primer Sequences

  • Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´
  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Expand to Read More »

  • Share
  • Print
  • Email
  • Prices valid for customers of Promega Singapore Pte Ltd only
Product Size Conc. Catalog # *List Price Order QTY Add to Cart

pUC/M13 Primer, Forward (17mer)

Close Window

pUC/M13 Primer, Forward (17mer)


  • pUC/M13 Primer, Forward (17mer)

    Q539A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5391 Please Enquire

pUC/M13 Primer, Reverse (17mer)

Close Window

pUC/M13 Primer, Reverse (17mer)


  • pUC/M13 Primer, Reverse (17mer)

    Q540A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5401 Please Enquire

pUC/M13 Primer, Reverse (22mer)

Close Window

pUC/M13 Primer, Reverse (22mer)


  • pUC/M13 Primer, Reverse (22mer)

    Q542A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5421 Please Enquire

pUC/M13 Primer, Forward (24mer)

Close Window

pUC/M13 Primer, Forward (24mer)


  • pUC/M13 Primer, Forward (24mer)

    Q560A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

10μg/ml Q5601 Please Enquire

Storage Conditions

Store at –20°C. The primers are supplied in sterile water.

For product intended use please see Patents & Disclaimers tab.

Use Restrictions

Q5391, Q5401, Q5421, Q5601 For Research Use Only. Not for Use in Diagnostic Procedures.

It appears that you have Javascript disabled. Our website requires Javascript to function correctly. For the best browsing experience, please enable Javascript.